📣 Help Shape the Future of UKRI's Gateway to Research (GtR)

We're improving UKRI's Gateway to Research and are seeking your input! If you would be interested in being interviewed about the improvements we're making and to have your say about how we can make GtR more user-friendly, impactful, and effective for the Research and Innovation community, please email gateway@ukri.org.

Control of G-quadruplex self-assembly through glycosidic bond angle

Lead Research Organisation: University of Ulster
Department Name: Sch of Biomedical Sciences

Abstract

In our planet nature has evolved for millions of years adapting and evolving. Whilst doing that it created and utilized codes to do so. So far as we can ascertain DNA sequence is the code for life as we see it. Currently various groups make use of this understanding of how nature uses its molecules to perform functions to develop highly organized nano-size materials, motors, and other tools with various functions both inside and outside cells. DNA is one of these molecules. The double-helical structure of DNA is not the only structure that it adopts. There is a particular architecture DNA folds into that looks more like a knot- it is known as G-quadruplex structure. DNA can thus also fold into many different forms of this architecture. Many of these knots are unexpectedly resistant to high temperatures and to degradation by exposure to enzymes. These properties, together with our understanding of other highly fine-tuned properties derived from evolution, make DNA a molecule that can be utilized for technological purposes. However, in order to realize their potential, we have to understand how to use them for design purposes. In this context, a fundamental question is what type of knots/forms can DNA adopt and how do we control their formation? We know that one of the four bases that make up DNA is mostly responsible for adoption of these knots; G. Sequential segments of Gs make up the knots. The G can be locked into two different positions. Utilizing this understanding we have previously established that there are 26 theoretically possible knots. Better yet, we have predicted that the context of the presence of the two states of G in the DNA molecule will control the precise knot DNA folds into. In this project our aim is to verify experimentally our prediction that it is possible to utilize the two states of G in the DNA sequence to control the folding of the 26 knots. Indeed, it is also currently known that the folding into these knots can be influenced by very small chemical modification of this G base. We will also systematically measure some of the properties that make these knots of interest as materials and tools. We will measure both their temperature stability and their resistance to enzymes. Lack of good performance in these two domains is usually the cause for not using molecules from cells for technological purposes. Our proposal is thus fundamental to the future use of DNA knots for technological purposes. There are two significant benefits of the proposed work. Firstly, we hope to establish that it is experimentally feasible to design these knots. This is important for making nanomaterials and biotechnological tools. Secondly, data generated from this work has the potential to predict knots formation from the DNA sequence. This is relevant since it allows for developing a method for finding these knots in the genome. Currently, this is of great interest since these knots happen to have controlling functions in the genome. Thus the association of type of knot with function will be made feasible.

Technical Summary

In order to realize programmed build up of DNA objects, devices, and materials, a systematization of the principles at the basis of control of the construction process is necessary. Much progress has been made in self-assembly of complementary (Watson-Crick) DNA. Here we propose establishing the rules for a rational approach towards the design of quadruplex topologies. Utilizing the formalism of quadruplex folding, based on a two-state disposition of the glycosidic bond angle, we have derived the sequence of stacking tetrad GBA combinations feasible for anti-parallel quadruplexes of three loops. In order to provide proof of concept validating this axiomatic approach we experimentally determined one of the hypothesized topologies. The control of the fold of this representative novel topology of three-stacked tetrads containing all three loop types was exerted through the length of the loops bridging the quadruplex stem. A single sequence was tried to achieve this topology. However, not all topologies can be discriminated through their loop length alone. Several issues may impede successful design; e.g. loop composition and its interactions may influence the topology, or the assembly of quadruplex entities may result in multistranded architectures, or both 5' and 3' ends may have to be modified to stabilize single folds. More often than not, the sum of these factors in tandem determines the final topology. To minimize these effects it is currently feasible to control the fold of quadruplexes by forcing the GBA of selected guanosines of the quadruplex stem to adopt the desired conformation. Therefore, knowledge of the sequence of GBA that a quadruplex stem is able to adopt will, in principle, enable the rational design of quadruplex topologies. NMR spectroscopy is the most appropriate technique to perform this study, since it allows for the rigorous assessment of the self-assembled topologies.

Planned Impact

DNA G-quadruplexes are unusually temperature and enzyme resistant. These properties make them suitable candidates for biotechnological use. This project creates a knowledge and understanding platform that may enable the development of various pharmaceutical and biotechnological products. Who would be the users and beneficiaries of this research outside the research community? Some obvious industrial beneficiaries are: (i) Companies with an interest in developing molecular electronics based on DNA. (ii) Companies interested in developing DNA technology tools (iii) Companies interested in the development of DNAzymes and chemical biology tools. (iv) Existing companies interested in developing aptamers to target diseases and disease states. (v) Companies interested in selecting G-quadruplex targets for drug discovery. Efforts by the PI to engage industrial stakeholders In the biotechnological context, the PI has been involved in the European Science Foundation COST Action MP0802, 'Self-assembled guanosine structures for molecular electronic devices' (06/2008 - 06/2012). The Action includes the participation of various industrial stakeholders and has as its main objective the development of molecular electronics based on quadruplex nucleic acids. We have been voted coordinator for one of the four Working Groups- 'Biochemical & Biorecognition Properties'. The first of the stated objectives of this working group is develop understanding of the rules for G-quadruplex unimolecular and macromolecular self-assembly- the overall objective of this proposal. The Action has started recently. The PI expects to have direct access to, and feed-back from industrial stakeholders involved once opportunities arise. Thus mechanisms for identifying opportunities are in place. As one of two country representatives the PI is in the process of recruiting more industrial participants from the UK to this Action. Still in the biotechnological context the PI is invited speaker to the European Science Foundation research conference on 'Self-assembly of Guanosine Derivatives: from Biological Systems to Nanotechnological Applications', Innsbruck, Austria, to be held on 20-25/06/2009. This meeting includes the participation of various industrial stakeholders. In it the PI is going to present results of the application of the formalism of quadruplex folding to inform these stakeholders of the potential benefits in applying its principles in their developments of technological tools. These initial steps should pay off once the outcomes of this project become known. The PI would then be in a position of applying control of quadruplex folding to any specific industrial partner's aims identified. Realization of the Potential Results of this Proposal by the PI In the pharmaceutical context, by developing this platform knowledge on control of quadruplex folding we intend to pursue specific projects towards generating patents. The University of Ulster has schemes in place to convert potential ideas and results from research into products of industrial value. Thus any exploitable results will first be communicated to the Office of Innovation. At the University of Ulster the Office of Innovation includes an expert team that is responsible for the capture, protection and commercialisation of Ulster's intellectual capital by providing support for intellectual property management, technology licensing, Spin-Out Company Creation and Industrial Collaborations. At any time if an opportunity is identified by researchers at Ulster University one may contact directly a member of this team by phone or through a dedicated webpage. To support the clustering of knowledge-based companies, the University of Ulster has also established various Science Research Parks. Thus, methods for communication and engagement with industrial stake holders are current practice by experienced staff that is available to the PI of this proposal.

Publications

10 25 50
publication icon
Dvorkin SA (2018) Encoding canonical DNA quadruplex structure. in Science advances

publication icon
Hessari NM (2014) Programmed self-assembly of a quadruplex DNA nanowire. in Chemistry (Weinheim an der Bergstrasse, Germany)

publication icon
Ilc T (2013) Formation of G-Wires: The Role of G:C-Base Pairing and G-Quartet Stacking in The Journal of Physical Chemistry C

publication icon
Karsisiotis AI (2011) Topological characterization of nucleic acid G-quadruplexes by UV absorption and circular dichroism. in Angewandte Chemie (International ed. in English)

publication icon
Karsisiotis AI (2012) Structural probes in quadruplex nucleic acid structure determination by NMR. in Molecules (Basel, Switzerland)

publication icon
Karsisiotis AI (2013) DNA quadruplex folding formalism--a tutorial on quadruplex topologies. in Methods (San Diego, Calif.)

publication icon
Randazzo A (2013) Circular dichroism of quadruplex structures. in Topics in current chemistry

 
Description We know that DNA forms a double stranded architecture. DNA also forms four-stranded architectures known as Quadruplexes, or G-quadruplexes. The four stranded architectures are resistant to enzymes, temperature, and can adopt a variety of shapes. This rich variety of shapes is useful for biotechnological, therapeutic, nanomechanical, and bioelectronics applications. Of importance is also the fact that these architectures are important for biological function.

Our main discovery has been the development of rules for engineering these architectures. Other significant advances include (i) improved prediction of the architectures they form in biological systems (ii) developed inexpensive and fast methods for structural characterization of these architectures in preparation for a variety of applications.
Exploitation Route It is now feasible to work on prediction of G-quadruplex formation in biological systems.
We have developed rules for the engineering of four-stranded nucleic acids architectures known as quadruplexes, and developed methodology for fast inexpensive characterization. For this latter purpose we have had to categorize these architectures in terms of their 3D structures. The rules have been published (and continue to be published) in current literature, and have been used by users developing biotechnological devices, therapeutics, and nanoelectronics. The categorization of these architectures is currently becoming of common use in the literature, and the characterization method is the gold standard for fast categorization of G-quadruplex DNA.
Sectors Chemicals

Electronics

Energy

Healthcare

Pharmaceuticals and Medical Biotechnology

URL http://www.rcsb.org/pdb/results/results.do?tabtoshow=Current&qrid=D1F4A72D
 
Description The Research Associate under training in this grant has now taken up a permanent post at the University of Essex. A "Science meets Society" output has been published on a publication where the bulk of the work funded appears (Sci. Adv. 4, eaat3007 (2018). The publication appears online at https://doi.org/10.25250/thescbr.brk186.
First Year Of Impact 2013
Sector Education
Impact Types Cultural

Societal

 
Description Department of Education and Learning Northern Ireland
Amount £58,000 (GBP)
Organisation Ulster University 
Department School of Biomedical Sciences
Sector Academic/University
Country United Kingdom
Start 08/2011 
End 09/2014
 
Description Department of Education and Learning Northern Ireland
Amount £58,000 (GBP)
Organisation Ulster University 
Department School of Biomedical Sciences
Sector Academic/University
Country United Kingdom
Start 08/2013 
End 09/2016
 
Title Atomic detail structure of the G-quadruplex 2MFT 
Description Atomic detail solution structure formed in sodium solution by the DNA sequence d(GGGTTTTGGGTGGGTTTTGGG) 
Type Of Material Biological samples 
Year Produced 2014 
Provided To Others? Yes  
Impact DNA scaffold for building biotechnological and therapeutic devices 
URL http://www.rcsb.org/pdb/explore/explore.do?structureId=2MFT
 
Title Atomic detail structure of the G-quadruplex 2MO6 
Description G-quadruplex solution structure formed by the sequenced (GGGTTTTGGGTTTTGGGAGGG) in sodium solution 
Type Of Material Biological samples 
Year Produced 2014 
Provided To Others? Yes  
Impact This atomic detail structure can be used to develop molecules targeting G-quadruplexes. It can be used for the development of aptamers and biological sensors 
 
Title DNA G-quadruplex structure 2M6W 
Description A solution structure of a DNA quadruplex formed in sodium conditions by the sequence d(GGGGTTGGGGTTTTGGGGAAGGGG) 
Type Of Material Biological samples 
Year Produced 2014 
Provided To Others? Yes  
Impact A nucleic acid scaffold for building biotechnological and therapeutic tools 
URL http://www.rcsb.org/pdb/explore/explore.do?structureId=2M6W
 
Title G-quadruplex in intron of N-myc gene, 2LED 
Description Receptor for modulating expression of N-myc. 
Type Of Material Biological samples 
Year Produced 2015 
Provided To Others? Yes  
Impact Molecules can be designed to target modulation of expression of N-myc from this model. Aptamer for N-myc. Scaffold for building therapeutic and diagnostic devices 
URL http://www.rcsb.org/pdb/explore/explore.do?structureId=2LED
 
Title G-quadruplex in intron of N-myc gene, 2LEE 
Description Receptor for modulation of expression of N-MYC. 
Type Of Material Biological samples 
Year Produced 2015 
Provided To Others? Yes  
Impact Molecules targeting modulation of N-MYC expression can be developed based on this model. Therapeutic and sensor devices can also be developed based on this model. 
URL http://www.rcsb.org/pdb/explore/explore.do?structureId=2LEE
 
Title Method to Characterize G-Quadruplex Topologies in Solution through Light Absorption 
Description G-quadruplexes are four-stranded nucleic acids architectures of current interest in developing biotechnologies, nanomechanical components, and therapeutics. G-quadruplex nucleic acids can be classified topologically in three different classes according to the base stacking interactions within the stem of the architecture. We developed a method for identifying these classes utilizing any simple and inexpensive UV-VIS spectrophotometer, or an instrument for measuring Circular Dichroism. 
Type Of Material Technology assay or reagent 
Year Produced 2011 
Provided To Others? Yes  
Impact It has become possible to easier and less expensive to structurally characterize G-quadruplexes in solution. The method is currently used by many in the area of research. A byproduct of the work was the characterization of G-quadruplex topologies in three different classes- this is currently become common practice. 
URL http://onlinelibrary.wiley.com/doi/10.1002/anie.201105193/abstract
 
Title Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions 
Description Atomic detail structures for the DNA sequence d(GGGTTGGGTTTTGGGTGGG) in sodium conditions 
Type Of Material Biological samples 
Year Produced 2014 
Provided To Others? Yes  
Impact Structure diversity of G-quadruplex architectures that can be used as therapeutics, sensors, etc 
URL http://www.rcsb.org/pdb/explore/explore.do?structureId=2M6V
 
Title Solution structure of the G-quadruplex 2MFU 
Description Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions 
Type Of Material Biological samples 
Year Produced 2014 
Provided To Others? Yes  
Impact DNA scaffold for building biotechnological devices and therapeutics 
URL http://www.rcsb.org/pdb/explore/explore.do?structureId=2MFU
 
Title Atomic detail structure of the G-quadruplex 2MFT 
Description Atomic detail solution structure formed in sodium solution by the DNA sequence d(GGGTTTTGGGTGGGTTTTGGG) 
Type Of Material Database/Collection of data 
Year Produced 2014 
Provided To Others? Yes  
Impact DNA scaffold for building biotechnological and therapeutic devices 
URL http://www.rcsb.org/pdb/explore/explore.do?structureId=2MFT
 
Title Atomic detail structure of the G-quadruplex 2MO6 
Description G-quadruplex solution structure formed by the sequenced (GGGTTTTGGGTTTTGGGAGGG) in sodium solution 
Type Of Material Database/Collection of data 
Provided To Others? No  
Impact The structure is in the process of being made publicly available (deposition) 
 
Title DNA G-quadruplex structure 2M6W 
Description A solution structure of a DNA quadruplex formed in sodium conditions by the sequence d(GGGGTTGGGGTTTTGGGGAAGGGG) 
Type Of Material Database/Collection of data 
Year Produced 2014 
Provided To Others? Yes  
Impact A nucleic acid scaffold for building biotechnological and therapeutic tools 
URL http://www.rcsb.org/pdb/explore/explore.do?structureId=2M6W
 
Title Method to Characterize G-Quadruplex Topologies in Solution through Light Absorption 
Description G-quadruplexes are four-stranded nucleic acids architectures of current interest in developing biotechnologies, nanomechanical components, and therapeutics. G-quadruplex nucleic acids can be classified topologically in three different classes according to the base stacking interactions within the stem of the architecture. We developed a method for identifying these classes utilizing any simple and inexpensive UV-VIS spectrophotometer, or an instrument for measuring Circular Dichroism. 
Type Of Material Data analysis technique 
Year Produced 2011 
Provided To Others? Yes  
Impact It has become possible to easier and less expensive to structurally characterize G-quadruplexes in solution. The method is currently used by many in the area of research. A byproduct of the work was the characterization of G-quadruplex topologies in three different classes- this is currently become common practice. 
URL http://onlinelibrary.wiley.com/doi/10.1002/anie.201105193/abstract
 
Title Solution structure of the G-quadruplex 2MFU 
Description Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions 
Type Of Material Database/Collection of data 
Year Produced 2014 
Provided To Others? Yes  
Impact DNA scaffold for building biotechnological devices and therapeutics 
URL http://www.rcsb.org/pdb/explore/explore.do?structureId=2MFU
 
Description Collaboration with A. Randazzo (Napoli) and G.P. Spada (Bologna) 
Organisation University of Bologna
Country Italy 
Sector Academic/University 
PI Contribution We discovered a method for characterizing topological characteristics of G-quadruplexes utilizing Circular Dichroism by comparing the spectra available in the literature. We categorized the topological characteristics of G-quadruplexes following our formalism of G-quadruplex folding, and prepared samples for each of the categories. Since we do not have a CD instrument we surmised that distinguishing topological characteristics could also be achieved utilizing UV-VIS. We did confirm this hypothesis by UV-VIS and decided to investigate the corresponding CD spectra with collaborators.
Collaborator Contribution Collaborators have an established name in CD. They made measurements on our samples. We published the resultant methodological development in Angewandte Chemie in 2011. It is now a popular way to classify and characterize G-quadruplexes. The partnership continues with Prof Randazzo on further developing characterization by CD (Prof GP Spada has since passed away).
Impact Collaboration is multidisciplinary scientific areas (biophysics, physical chemistry, and organic synthesis of modified nucleic acids). Outputs thus far: scientific publications: peer-reviewed publication: • A. I. Karsisiotis, N. M. Hessari, Ettore Novellino, G. P. Spada,* A. Randazzo,* M. Webba da Silva*. Topological Characterization of G-Quadruplexes by UV Absorption and Circular Dichroism, Angew. Chem. Int. Ed. Engl. 50 (2011) 10645-10648. book: • A. Randazzo, G-P. Spada, and M. Webba da Silva. Circular Dichroism of Quadruplex Structures, Top. Curr. Chem. (Springer-Verlag, Berlin, Heidelberg) Volume 330, pages 67 - 86. DOI: 10.1007/128_2012_331 (2012). ISBN 978-3-642-34742-9. Book title: Quadruplex Nucleic Acids. Edited by Jonathan B. Chaires, and David Graves; Springer Berlin Heidelberg.
Start Year 2010
 
Description Collaboration with A. Randazzo (Napoli) and G.P. Spada (Bologna) 
Organisation University of Naples
Country Italy 
Sector Academic/University 
PI Contribution We discovered a method for characterizing topological characteristics of G-quadruplexes utilizing Circular Dichroism by comparing the spectra available in the literature. We categorized the topological characteristics of G-quadruplexes following our formalism of G-quadruplex folding, and prepared samples for each of the categories. Since we do not have a CD instrument we surmised that distinguishing topological characteristics could also be achieved utilizing UV-VIS. We did confirm this hypothesis by UV-VIS and decided to investigate the corresponding CD spectra with collaborators.
Collaborator Contribution Collaborators have an established name in CD. They made measurements on our samples. We published the resultant methodological development in Angewandte Chemie in 2011. It is now a popular way to classify and characterize G-quadruplexes. The partnership continues with Prof Randazzo on further developing characterization by CD (Prof GP Spada has since passed away).
Impact Collaboration is multidisciplinary scientific areas (biophysics, physical chemistry, and organic synthesis of modified nucleic acids). Outputs thus far: scientific publications: peer-reviewed publication: • A. I. Karsisiotis, N. M. Hessari, Ettore Novellino, G. P. Spada,* A. Randazzo,* M. Webba da Silva*. Topological Characterization of G-Quadruplexes by UV Absorption and Circular Dichroism, Angew. Chem. Int. Ed. Engl. 50 (2011) 10645-10648. book: • A. Randazzo, G-P. Spada, and M. Webba da Silva. Circular Dichroism of Quadruplex Structures, Top. Curr. Chem. (Springer-Verlag, Berlin, Heidelberg) Volume 330, pages 67 - 86. DOI: 10.1007/128_2012_331 (2012). ISBN 978-3-642-34742-9. Book title: Quadruplex Nucleic Acids. Edited by Jonathan B. Chaires, and David Graves; Springer Berlin Heidelberg.
Start Year 2010
 
Description Collaboration with Janez Plavec, National Institute of Chemistry (Slovenia) 
Organisation National Institute of Chemistry, Slovenia
Country Slovenia 
Sector Academic/University 
PI Contribution We have discovered evidence for G-quadruplex folding region in nMYC gene, and provided some evidence for a well-folded architecture. We have also previously had collaborative enterprises on the same theme: controlling the folding of G-quadruplexes. Generally we define the control of folding through design
Collaborator Contribution Janez Plavec's group in Slovenia determined two solution structures formed by nMYC in the same sequence in physiological conditions. For other collaborations (including those ongoing) this group has allowed us access to their high field facilities for NMR experimentation. There are times in which they acquire data for us in their instruments. Other times they go all the way to structure determination.
Impact Scientific publications: • Tina Ilc, Primož Šket, Janez Plavec, Mateus Webba da Silva, Irena Drevenšek-Olenik, Lea Spindler*. Formation of G- wires: the Role of G:C-base Pairing and G-quartet Stacking, J. Phys. Chem. C, 117 (2013) 23208 - 23215. • Tina Ilc, Primož Šket, Janez Plavec, Mateus Webba da Silva, Irena Drevenšek-Olenik, Lea Spindler*. Formation of G- wires: the Role of G:C-base Pairing and G-quartet Stacking, J. Phys. Chem. C, 117 (2013) 23208 - 23215. • M. Webba da Silva,* M. Trajkovski, Y. Sannohe, N. M. Hessari, H. Sugiyama, J. Plavec*. Design of a G-Quadruplex Topology through Glycosidic Bond Angles, Angew. Chem. Int. Ed. Engl. 48 (2009) 9167-9170.
Start Year 2007
 
Title QUADPAINTER 
Description A rules-based computational algorithm that defines feasible 3D quadruplex topologies based on the geometric principles of quadruplex folding 
Type Of Technology Webtool/Application 
Year Produced 2013 
Impact The algorithm is still under development since the rules for defining G-quadruplex structure are still under investigation. However, it has been passed to colleagues that are also working on the development of these rules.